Cambridge biotech STORM Therapeutics raises $56M

Introduction

In this tutorial, you'll learn how to work with RNA-modifying enzymes and their inhibitors using Python and basic bioinformatics tools. This tutorial is based on the recent funding of STORM Therapeutics, a company developing STC-15, the world's first RNA-modifying enzyme inhibitor to reach human trials. While you won't be conducting actual clinical trials, you'll gain foundational knowledge about how these inhibitors work and how to analyze RNA modification data.

Prerequisites

Before starting this tutorial, you should have:

• Basic understanding of biology concepts (DNA, RNA, proteins)
• Python installed on your computer
• Basic familiarity with command-line tools
• Access to a text editor or IDE

Step-by-Step Instructions

1. Install Required Python Libraries

First, we need to install the necessary Python libraries for working with biological data. Open your terminal or command prompt and run:

pip install biopython numpy pandas matplotlib

Why this step? These libraries will help us handle biological sequences, perform calculations, and visualize data related to RNA modifications.

2. Create a Python Script for RNA Analysis

Create a new file called rna_analysis.py and open it in your text editor. This script will help us understand how RNA-modifying enzymes work.

import numpy as np
import pandas as pd

# Define a simple representation of RNA sequences
rna_sequence = "AUGGCCUUUAAAGGGCCCUUU"

print("Original RNA Sequence:", rna_sequence)
print("Length of sequence:", len(rna_sequence))

# Count nucleotides
nucleotide_counts = {
    'A': rna_sequence.count('A'),
    'U': rna_sequence.count('U'),
    'G': rna_sequence.count('G'),
    'C': rna_sequence.count('C')
}

print("Nucleotide counts:", nucleotide_counts)

Why this step? This basic script shows how we can analyze RNA sequences, which is fundamental to understanding how RNA-modifying enzymes affect these sequences.

3. Simulate RNA Modification Effects

Let's simulate how an RNA-modifying enzyme might change our sequence:

# Simulate RNA modification
modified_sequence = rna_sequence.replace('A', 'm6A')
print("Modified sequence (A replaced with m6A):", modified_sequence)

# Create a function to simulate different modifications
def simulate_modification(sequence, original_base, modified_base):
    return sequence.replace(original_base, modified_base)

# Test with different modifications
m1a_sequence = simulate_modification(rna_sequence, 'U', 'm1A')
print("m1A modification:", m1a_sequence)

Why this step? RNA modifications like m6A (N6-methyladenosine) are crucial in gene regulation. This simulation helps us understand how modifications affect RNA structure and function.

4. Create a Simple Data Structure for RNA Modifications

Now let's create a more realistic representation of RNA modification data:

# Create a DataFrame to represent RNA modification data
modification_data = {
    'position': [1, 2, 3, 4, 5, 6, 7, 8, 9, 10],
    'original_base': ['A', 'U', 'G', 'C', 'C', 'U', 'U', 'U', 'A', 'A'],
    'modified_base': ['m6A', 'U', 'm5C', 'C', 'C', 'U', 'U', 'U', 'A', 'm1A'],
    'modification_type': ['m6A', 'none', 'm5C', 'none', 'none', 'none', 'none', 'none', 'none', 'm1A']
}

df = pd.DataFrame(modification_data)
print("RNA Modification Data:")
print(df)

# Calculate modification frequency
modification_frequency = df['modification_type'].value_counts()
print("\nModification frequency:")
print(modification_frequency)

Why this step? This simulates real-world data that researchers might collect when studying RNA modifications, similar to what STORM Therapeutics would analyze in their research.

5. Visualize RNA Modification Data

Let's visualize our RNA modification data to better understand the patterns:

import matplotlib.pyplot as plt

# Plot modification positions
plt.figure(figsize=(10, 6))
plt.bar(df['position'], df['original_base'], label='Original Base', alpha=0.7)
plt.bar(df['position'], df['modified_base'], label='Modified Base', alpha=0.7)
plt.xlabel('Position in RNA Sequence')
plt.ylabel('Nucleotide')
plt.title('RNA Sequence with Modifications')
plt.legend()
plt.show()

Why this step? Visualization helps researchers understand patterns in RNA modifications, which is crucial for drug development like STC-15.

6. Analyze the Impact of Modifications

Let's create a function to analyze how modifications might affect RNA function:

# Function to analyze modification impact
def analyze_modification_impact(modified_sequence):
    # Simple analysis: count modifications
    modification_count = modified_sequence.count('m')
    
    # Calculate modification percentage
    total_bases = len(modified_sequence)
    modification_percentage = (modification_count / total_bases) * 100
    
    return {
        'total_modifications': modification_count,
        'modification_percentage': modification_percentage,
        'sequence_length': total_bases
    }

# Test our analysis function
result = analyze_modification_impact(m1a_sequence)
print("Modification Analysis Result:")
for key, value in result.items():
    print(f"{key}: {value}")

Why this step? Understanding the impact of modifications is crucial for developing effective RNA-modifying enzyme inhibitors like STC-15.

7. Run Your Complete Script

Save your script and run it in the terminal:

python rna_analysis.py

Why this step? Running the script will show you how RNA modifications work and how they might be analyzed in real research settings.

Summary

In this tutorial, you've learned how to work with RNA modification data using Python. You've created a basic analysis framework that simulates how RNA-modifying enzymes work and how their inhibitors might affect RNA sequences. While this is a simplified representation, it mirrors the kind of analysis that companies like STORM Therapeutics use in their research to develop treatments for cancer.

The concepts you've learned include basic RNA sequence analysis, simulation of modifications, data visualization, and impact assessment - all fundamental to understanding how RNA-modifying enzyme inhibitors work in clinical research.